View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0805-3 (Length: 217)
Name: NF0805-3
Description: NF0805
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0805-3 |
| |
|
[»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 8 - 217
Target Start/End: Original strand, 49085964 - 49086173
Alignment:
Q |
8 |
gatgaggccaagatcctgcttttagctggaagaattgcatttgcaggaatgatttcgtccgttcttacattatttctgtgccnnnnnnngagtagaatat |
107 |
Q |
|
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
T |
49085964 |
gatgaagccaagatcctgcttttagctggaagaattgcatttgcaggaatgatttcgtccgttcttacattatttctgtgcctttttttgagtagaatat |
49086063 |
T |
|
Q |
108 |
aagcacgattcataaaatatactctcaaattgtattttatcattcaaaaagattttttaaataacgcttcgaaacattgatgaattctgctactgtaatc |
207 |
Q |
|
|
||||| |||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| | |
|
|
T |
49086064 |
aagcaagattcataaaatatgctctaaaattgtattttatcattcaaaaagattttttaaataacgcttcgaaacattgatgaattctgcttctgtaacc |
49086163 |
T |
|
Q |
208 |
atttggggat |
217 |
Q |
|
|
|||||||||| |
|
|
T |
49086164 |
atttggggat |
49086173 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 13230 times since January 2019
Visitors: 8270