View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0851-INSERTION-11 (Length: 271)
Name: NF0851-INSERTION-11
Description: NF0851
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0851-INSERTION-11 |
| |
|
[»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 18 - 271
Target Start/End: Complemental strand, 36676346 - 36676094
Alignment:
Q |
18 |
ttagattaacgatgagtttcgtagaatcacggtgttgtcactttgattttaaactcatcgtgattataacatgcagttacatgttcttggtcgaacttta |
117 |
Q |
|
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
36676346 |
ttagattaacgatgagtttcgtagaatcacggtgt-gtcactttgattttaaactcatcgtgattataacatgcagttacatgttcttggtcgaacttta |
36676248 |
T |
|
Q |
118 |
gattaccagagctcccttcttctagaaactagagggctaagac-aaaacaaaaaactgagtgtgtttgtttatttgttgttggtgaatgcagggtgatca |
216 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
36676247 |
gattaccagagctcccttcttctagaaactagagggctaagacaaaaacaaaaaactgagtgtgtttgtttatttgttgttggtgaatgcagggtgatca |
36676148 |
T |
|
Q |
217 |
agcttcctataattggaggagctattaacctttgtt-aagagcttgagcacaagtt |
271 |
Q |
|
|
||||| |||||||||||||||||||||| ||||||| ||||||||||||||||||| |
|
|
T |
36676147 |
agctt-ctataattggaggagctattaa-ctttgttaaagagcttgagcacaagtt |
36676094 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 11056 times since January 2019
Visitors: 8059