View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0851_high_23 (Length: 274)
Name: NF0851_high_23
Description: NF0851
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0851_high_23 |
| |
|
Alignment Details
Target: chr1 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 30 - 263
Target Start/End: Original strand, 38952653 - 38952886
Alignment:
Q |
30 |
ggtcttgcaatctatacaaatctactttacgaatatcttccttcttcccttggatgatattgaaattttcatgcattcctttttgggggcgacaaatcta |
129 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
38952653 |
ggtcttgcaatctatacaaatctactttacgaatatcttccttcttcccttggatgatattgaaattttcatgcattcctttttgggggcgacaaatcta |
38952752 |
T |
|
Q |
130 |
atgatagtaaaggcattagatggatgtcttgggatcacatggaggaatgggtttttgcaatttatacacttccaacctatctttgttgggaaaccaagga |
229 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
38952753 |
atgatagtaaaggcattagatggatgtcttgggatcacatggaggaatgggtttttgcaatttatacacttccaacctatctttgttgggaaaccaagga |
38952852 |
T |
|
Q |
230 |
tggcgcataatgattcaatcagacacatgttcat |
263 |
Q |
|
|
||||||||||||| |||||||||||||||||||| |
|
|
T |
38952853 |
tggcgcataatgactcaatcagacacatgttcat |
38952886 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 13639 times since January 2019
Visitors: 8302