View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0851_high_23 (Length: 274)

Name: NF0851_high_23
Description: NF0851
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0851_high_23
NF0851_high_23
[»] chr1 (1 HSPs)
chr1 (30-263)||(38952653-38952886)


Alignment Details
Target: chr1 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 30 - 263
Target Start/End: Original strand, 38952653 - 38952886
Alignment:
30 ggtcttgcaatctatacaaatctactttacgaatatcttccttcttcccttggatgatattgaaattttcatgcattcctttttgggggcgacaaatcta 129  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38952653 ggtcttgcaatctatacaaatctactttacgaatatcttccttcttcccttggatgatattgaaattttcatgcattcctttttgggggcgacaaatcta 38952752  T
130 atgatagtaaaggcattagatggatgtcttgggatcacatggaggaatgggtttttgcaatttatacacttccaacctatctttgttgggaaaccaagga 229  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38952753 atgatagtaaaggcattagatggatgtcttgggatcacatggaggaatgggtttttgcaatttatacacttccaacctatctttgttgggaaaccaagga 38952852  T
230 tggcgcataatgattcaatcagacacatgttcat 263  Q
    ||||||||||||| ||||||||||||||||||||    
38952853 tggcgcataatgactcaatcagacacatgttcat 38952886  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 13639 times since January 2019
Visitors: 8302