View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0851_high_30 (Length: 208)
Name: NF0851_high_30
Description: NF0851
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0851_high_30 |
| |
|
Alignment Details
Target: chr7 (Bit Score: 99; Significance: 5e-49; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 54 - 188
Target Start/End: Complemental strand, 39836309 - 39836178
Alignment:
Q |
54 |
gactgagctaaaaattgaaatttagacgatctagaacaaaacattatgaagtaatgacttgaaatatcagtttattgattannnnnnnngttgcaaaaag |
153 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
T |
39836309 |
gactgagctaaaaattgaaatttagacgatctagaacaaaacattatgaagtaatgacttgaaatatcagtttattgatt---tttttttttgcaaaaag |
39836213 |
T |
|
Q |
154 |
atgtaaaatattattagttctatatacaccattct |
188 |
Q |
|
|
||||||||||||||||||||||||||||||||||| |
|
|
T |
39836212 |
atgtaaaatattattagttctatatacaccattct |
39836178 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 8632 times since January 2019
Visitors: 7803