View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0851_low_16 (Length: 393)
Name: NF0851_low_16
Description: NF0851
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0851_low_16 |
| |
|
Alignment Details
Target: chr3 (Bit Score: 115; Significance: 3e-58; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 115; E-Value: 3e-58
Query Start/End: Original strand, 78 - 200
Target Start/End: Complemental strand, 52592988 - 52592866
Alignment:
Q |
78 |
aatatcaaaaacccggatttgaataaatgataaccaaacagggaacaatccattatacaaataaattatgttcttatatgcttgaaatgctttgtttttt |
177 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||| |
|
|
T |
52592988 |
aatatcaaaaacccggatttgaataaatgataaccaaacagggaacaatccattatacaaataaattctgttcttacatgcttgaaatgctttgtttttt |
52592889 |
T |
|
Q |
178 |
atggttgaaattacactggtcac |
200 |
Q |
|
|
||||||||||||||||||||||| |
|
|
T |
52592888 |
atggttgaaattacactggtcac |
52592866 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 268 - 296
Target Start/End: Complemental strand, 52592800 - 52592772
Alignment:
Q |
268 |
taatagcccaatatagtctataaactaat |
296 |
Q |
|
|
||||||||||||||||||||||||||||| |
|
|
T |
52592800 |
taatagcccaatatagtctataaactaat |
52592772 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 14703 times since January 2019
Visitors: 8422