View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0851_low_21 (Length: 362)
Name: NF0851_low_21
Description: NF0851
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0851_low_21 |
| |
|
Alignment Details
Target: chr4 (Bit Score: 60; Significance: 2e-25; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 1 - 64
Target Start/End: Complemental strand, 1869574 - 1869511
Alignment:
Q |
1 |
catcatttgtaaggtacataatgctctaaaagagtctcatttttcttttaaaaaacatttgcgg |
64 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
T |
1869574 |
catcatttgtaaggtacataatgctctaaaagagtctcatttttcttttaaaaaacatatgcgg |
1869511 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 12538 times since January 2019
Visitors: 8220