View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0851_low_22 (Length: 362)

Name: NF0851_low_22
Description: NF0851
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0851_low_22
NF0851_low_22
[»] chr4 (1 HSPs)
chr4 (1-64)||(1869511-1869574)


Alignment Details
Target: chr4 (Bit Score: 60; Significance: 2e-25; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 1 - 64
Target Start/End: Complemental strand, 1869574 - 1869511
Alignment:
1 catcatttgtaaggtacataatgctctaaaagagtctcatttttcttttaaaaaacatttgcgg 64  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||    
1869574 catcatttgtaaggtacataatgctctaaaagagtctcatttttcttttaaaaaacatatgcgg 1869511  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 9597 times since January 2019
Visitors: 7932