View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0851_low_41 (Length: 251)
Name: NF0851_low_41
Description: NF0851
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0851_low_41 |
| |
|
[»] scaffold0989 (1 HSPs) |
| | |
|
[»] scaffold1089 (1 HSPs) |
| | |
|
Alignment Details
Target: chr6 (Bit Score: 226; Significance: 1e-125; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 226; E-Value: 1e-125
Query Start/End: Original strand, 1 - 242
Target Start/End: Original strand, 7815554 - 7815795
Alignment:
Q |
1 |
taggattcaagaagtattgacctgctggccaaggatatctttaggatgtaaactttcatttgaatgagtatagttactagaattgtcggttttttcattt |
100 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
7815554 |
taggattcaagaagtattgacctgctggccaaggatatctttaggatgtaaactttcatttgaatgagtatagttactagaattgtcggttttttcatta |
7815653 |
T |
|
Q |
101 |
gtttatattctatatatgttgcaactatttagtttgttagttcagacaacatatatggtagattaccattgcgactcaataataattatgtttcgatgct |
200 |
Q |
|
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
T |
7815654 |
gtttatattctaaatatgttgcaactatttagtttgttagttcagacaacatatatggtagattaccattgcgactcaacaataattatgtttcgatgct |
7815753 |
T |
|
Q |
201 |
tttaattttattttgctctattacattgatagtgagaattat |
242 |
Q |
|
|
||||||||||||||||||||||||||||| |||||||||||| |
|
|
T |
7815754 |
tttaattttattttgctctattacattgaaagtgagaattat |
7815795 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 179 - 240
Target Start/End: Complemental strand, 14435372 - 14435311
Alignment:
Q |
179 |
ataataattatgtttcgatgcttttaattttattttgctctattacattgatagtgagaatt |
240 |
Q |
|
|
|||| |||| ||||| |||||||| ||||||||||||||||||| |||||| |||||||||| |
|
|
T |
14435372 |
ataacaattctgtttggatgctttaaattttattttgctctattgcattgaaagtgagaatt |
14435311 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 180 - 240
Target Start/End: Complemental strand, 7895982 - 7895922
Alignment:
Q |
180 |
taataattatgtttcgatgcttttaattttattttgctctattacattgatagtgagaatt |
240 |
Q |
|
|
|||| ||||||||| ||||||||||| ||||||||||| |||| |||||| |||||||||| |
|
|
T |
7895982 |
taatgattatgtttggatgcttttaaatttattttgctttattgcattgaaagtgagaatt |
7895922 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0989 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: scaffold0989
Description:
Target: scaffold0989; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 179 - 240
Target Start/End: Original strand, 95 - 156
Alignment:
Q |
179 |
ataataattatgtttcgatgcttttaattttattttgctctattacattgatagtgagaatt |
240 |
Q |
|
|
|||| |||| ||||| |||||||| ||||||||||||||||||| |||||| |||||||||| |
|
|
T |
95 |
ataacaattctgtttggatgctttaaattttattttgctctattgcattgaaagtgagaatt |
156 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1089 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: scaffold1089
Description:
Target: scaffold1089; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 184 - 240
Target Start/End: Complemental strand, 482 - 426
Alignment:
Q |
184 |
aattatgtttcgatgcttttaattttattttgctctattacattgatagtgagaatt |
240 |
Q |
|
|
|||| ||||| |||||| ||||||||||||||||||||| ||||| |||||||||| |
|
|
T |
482 |
aattctgtttggatgctcttaattttattttgctctattgcattgtcagtgagaatt |
426 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 13422 times since January 2019
Visitors: 8302