View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0851_low_45 (Length: 221)
Name: NF0851_low_45
Description: NF0851
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0851_low_45 |
| |
|
Alignment Details
Target: chr1 (Bit Score: 113; Significance: 2e-57; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 31 - 147
Target Start/End: Complemental strand, 33237497 - 33237381
Alignment:
Q |
31 |
aagaaactaaaatagaacgaaaaataaacttaacggacctaggtgtcttacatttataacttaaggaaccaaaatggaacgaaaagaagatatataactt |
130 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
33237497 |
aagaaactaaaatagaacgaaaaataaacttaacggacctaggtgtcttacatttataacttaaggaaccaaaatggaacgaaaagaagatatataactt |
33237398 |
T |
|
Q |
131 |
acgatacacctatgata |
147 |
Q |
|
|
|||||||||| |||||| |
|
|
T |
33237397 |
acgatacaccaatgata |
33237381 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 10939 times since January 2019
Visitors: 8059