View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1264-Insertion-5 (Length: 213)
Name: NF1264-Insertion-5
Description: NF1264
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1264-Insertion-5 |
 | |
|
| [»] scaffold0329 (1 HSPs) |
| | |
|
Alignment Details
Target: chr2 (Bit Score: 164; Significance: 8e-88; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 164; E-Value: 8e-88
Query Start/End: Original strand, 10 - 211
Target Start/End: Complemental strand, 35128109 - 35127902
Alignment:
| Q |
10 |
aatctcttcgtaactcatacc-----attttgtctataaccatccaacacgccattaactaacttgcctattcgaa-gcttgaacacttgtaatgcacaa |
103 |
Q |
| |
|
||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||| |
|
|
| T |
35128109 |
aatctcttcgtaactcataccaatttaatttgtctataaccatccaacacgccattaactaacttgcctattctaaggcttgaacacttgtaatgcacaa |
35128010 |
T |
|
| Q |
104 |
cgatgaagccacactaattgaaatcaggcacctacaaaatttggcttcggatccacctgataaagagcatcttttaatgcatgagagaacgcaagacgac |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
35128009 |
cgatgaagccacactaattgaaatcaggcacctacaaaatttggcttaggatccacctgataaagagcatcttttaatgcatgagagaatgcaagacgac |
35127910 |
T |
|
| Q |
204 |
aagtatga |
211 |
Q |
| |
|
|||||||| |
|
|
| T |
35127909 |
aagtatga |
35127902 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 83 - 211
Target Start/End: Complemental strand, 35150033 - 35149905
Alignment:
| Q |
83 |
ttgaacacttgtaatgcacaacgatgaagccacactaattgaaatcaggcacctacaaaatttggcttcggatccacctgataaagagcatcttttaatg |
182 |
Q |
| |
|
|||||||| ||||||| |||||||||||||| | ||||||| ||| ||||||| | ||| |||||| ||||||| ||||||||||| |||||||||| |
|
|
| T |
35150033 |
ttgaacacctgtaatgagcaacgatgaagccatatcaattgaactcaagcacctagagaatatggcttaggatccatctgataaagagtgtcttttaatg |
35149934 |
T |
|
| Q |
183 |
catgagagaacgcaagacgacaagtatga |
211 |
Q |
| |
|
| | |||||| ||||||||| |||||||| |
|
|
| T |
35149933 |
cctaagagaatgcaagacgataagtatga |
35149905 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 20 - 66
Target Start/End: Complemental strand, 35150186 - 35150140
Alignment:
| Q |
20 |
taactcataccattttgtctataaccatccaacacgccattaactaa |
66 |
Q |
| |
|
||||||||||||| |||||||||||| |||||||| |||| |||||| |
|
|
| T |
35150186 |
taactcataccatcttgtctataaccctccaacacaccatcaactaa |
35150140 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 156 - 205
Target Start/End: Complemental strand, 6921615 - 6921566
Alignment:
| Q |
156 |
ccacctgataaagagcatcttttaatgcatgagagaacgcaagacgacaa |
205 |
Q |
| |
|
||||| |||||||||||||||||||||| |||||||| |||| ||||||| |
|
|
| T |
6921615 |
ccacccgataaagagcatcttttaatgcctgagagaatgcaaaacgacaa |
6921566 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0329 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0329
Description:
Target: scaffold0329; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 161 - 197
Target Start/End: Complemental strand, 16769 - 16733
Alignment:
| Q |
161 |
tgataaagagcatcttttaatgcatgagagaacgcaa |
197 |
Q |
| |
|
||||||||||||||||||||||| |||||||| |||| |
|
|
| T |
16769 |
tgataaagagcatcttttaatgcctgagagaatgcaa |
16733 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 8559 times since January 2019
Visitors: 7803