View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1265_low_11 (Length: 391)
Name: NF1265_low_11
Description: NF1265
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1265_low_11 |
| |
|
Alignment Details
Target: chr3 (Bit Score: 127; Significance: 2e-65; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 127; E-Value: 2e-65
Query Start/End: Original strand, 153 - 307
Target Start/End: Original strand, 2441061 - 2441215
Alignment:
Q |
153 |
ctttcattacccttgctgtgtagtatcattatgatggtggatttgactgccattaacaagcagctcttgtgtgtcccccctcccttaagctcttctggcc |
252 |
Q |
|
|
||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||| |||| |||||||||||||||||| |
|
|
T |
2441061 |
ctttcattaaccttgctgtgtagtatcattatgatggtggaattgactgccattaacaagcagttcttgtgtgtcctccctaccttaagctcttctggcc |
2441160 |
T |
|
Q |
253 |
attccctttacgacccgccacttcctacgcttccgtttgatttggtggcagagat |
307 |
Q |
|
|
|||| ||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
2441161 |
attcactttatgacccgccacttcctacgcttccgtttgatttggtggcagagat |
2441215 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 7 - 78
Target Start/End: Original strand, 2440788 - 2440857
Alignment:
Q |
7 |
gcaccacagagacaattgaaaatgaacgaaggagtaataatcacatatgtaggcaaaataaaaaaggaagtg |
78 |
Q |
|
|
|||||| | ||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||| |
|
|
T |
2440788 |
gcaccagaaagacaattgaaaatgaatgaaggagtaataat--catatgtaggcaaaataaaaaaggaagtg |
2440857 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 109 - 139
Target Start/End: Original strand, 2440980 - 2441010
Alignment:
Q |
109 |
atggtaatcgtgtttctcacgaaacctagcc |
139 |
Q |
|
|
||||||||||||||||||||||||||||||| |
|
|
T |
2440980 |
atggtaatcgtgtttctcacgaaacctagcc |
2441010 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 386 times since January 2019
Visitors: 8568