View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1265_low_20 (Length: 325)
Name: NF1265_low_20
Description: NF1265
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1265_low_20 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 102 - 325
Target Start/End: Complemental strand, 1602511 - 1602281
Alignment:
| Q |
102 |
cagcaggttgggaacagtaatagtctagatctaatgatcgttgaaggatgttaattactagatgttggaccattacaacttacgagttggatatgattca |
201 |
Q |
| |
|
||||||||||| || ||||||| |||||||||||||||||||||||||||||| |||||||||||||| || |||||||||||||||||||||||||||| |
|
|
| T |
1602511 |
cagcaggttggaaaaagtaataatctagatctaatgatcgttgaaggatgttagttactagatgttgggccgttacaacttacgagttggatatgattca |
1602412 |
T |
|
| Q |
202 |
atgatgatgatgatgagtcatggtggattgacctttgcttagtggacattgagttgatgaaaaatttggatcttaagttagtccagaa-------ctctc |
294 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
1602411 |
atgatgatgatgatgagttatggtggattgacctttgcttagtggacattgagttgatgaaaaatttggatcttaagttagtccagaacagtactctctc |
1602312 |
T |
|
| Q |
295 |
ttacatttactcatttacctccatgttatat |
325 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
1602311 |
ttacatttactcatttacctccatgttatat |
1602281 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2176 times since January 2019
Visitors: 8438