View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1311-Insertion-1 (Length: 228)
Name: NF1311-Insertion-1
Description: NF1311
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1311-Insertion-1 |
| |
|
[»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 8 - 228
Target Start/End: Complemental strand, 35756646 - 35756426
Alignment:
Q |
8 |
ctttcatttacttattaataatattatggattgtgtgattactatgatttattgtataggcatatcatatcatgtaaatacggataatatctcctatgtt |
107 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||| |
|
|
T |
35756646 |
ctttcatttacttattaataatattatggattgtgtgattactatgatttattgtataggcatatcatatcatgtaaatacggacaatatcgcctatgtt |
35756547 |
T |
|
Q |
108 |
tattttgtgcaattattgttttgagcttatataacatcgaatcccatgtctggtttaaacacacggtttcatcatatgtctcagtttcctctatttcaac |
207 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
35756546 |
tattttgtgcaattattgttttgagcttatataacatcgaatccgatgtctggtttaaacacacggtttcatcatatgtctcagtttcctctatttcaac |
35756447 |
T |
|
Q |
208 |
aatgttggtctaggtatttaa |
228 |
Q |
|
|
||||||||||||||||||||| |
|
|
T |
35756446 |
aatgttggtctaggtatttaa |
35756426 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 54 - 84
Target Start/End: Original strand, 49931912 - 49931942
Alignment:
Q |
54 |
atttattgtataggcatatcatatcatgtaa |
84 |
Q |
|
|
||||||||||||||||||||||||||||||| |
|
|
T |
49931912 |
atttattgtataggcatatcatatcatgtaa |
49931942 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 56 - 93
Target Start/End: Original strand, 45685367 - 45685404
Alignment:
Q |
56 |
ttattgtataggcatatcatatcatgtaaatacggata |
93 |
Q |
|
|
|||||||||||||||||||||||| ||||||| ||||| |
|
|
T |
45685367 |
ttattgtataggcatatcatatcaagtaaatagggata |
45685404 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 54 - 87
Target Start/End: Original strand, 43819037 - 43819070
Alignment:
Q |
54 |
atttattgtataggcatatcatatcatgtaaata |
87 |
Q |
|
|
||||| |||||||||||||||||||||||||||| |
|
|
T |
43819037 |
atttaatgtataggcatatcatatcatgtaaata |
43819070 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 16209 times since January 2019
Visitors: 3768