View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1311_high_12 (Length: 263)
Name: NF1311_high_12
Description: NF1311
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1311_high_12 |
| |
|
Alignment Details
Target: chr4 (Bit Score: 168; Significance: 4e-90; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 1 - 249
Target Start/End: Original strand, 52465650 - 52465902
Alignment:
Q |
1 |
aggacatatttctataagctatctttatcaagtggtaaacatatttctagaagacttatgtttgttgatgtgtgtttctggataatgatttatcagcaag |
100 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
T |
52465650 |
aggacatatttctataagctatctttatcaagtggtaaacatattcctagaagacttatgtttgttgatgtgtgtttctggacaatgatttatcagcaag |
52465749 |
T |
|
Q |
101 |
tggctcgggtaaagggtgtcatagatcttgaggtcggtgatgaatactaacccgaca-ttttttttattttaggcatattaaccggac----nnnnnnnn |
195 |
Q |
|
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||| ||| |
|
|
T |
52465750 |
tggctcgggtaaagggtgtcgtagatcttgaggtcggtgatgaatactaaccggacatttttttttattttaggcatattaacc-gacattttttttttt |
52465848 |
T |
|
Q |
196 |
nnnactaaccggacatcttgtatgtagctattctaaacagacttgcagaataat |
249 |
Q |
|
|
||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
T |
52465849 |
tttactaaccggacatcttgtatgtaactattctaaacagacttgcagaataat |
52465902 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 14660 times since January 2019
Visitors: 8422