View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1311_high_4 (Length: 620)
Name: NF1311_high_4
Description: NF1311
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1311_high_4 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 418; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 418; E-Value: 0
Query Start/End: Original strand, 8 - 533
Target Start/End: Complemental strand, 46357368 - 46356831
Alignment:
| Q |
8 |
gagcagagaccaaactcggaaccacacatttggacggcaccggtgaagaagatctcttcatcttccccgccggagatggatctctctcagcagaaacttt |
107 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46357368 |
gagcagaaaccaaactcggaaccacacatttggacggaaccggtgaagaagatctcttcatcttccccgccggagatggatctctctcagcagaaacttt |
46357269 |
T |
|
| Q |
108 |
accaaacttccctgcagattgtgatcgtttagcagttgccggagatgaaaatctcttaggcgttggtaagttatctcgtggagcaagtggttgccgtgaa |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
46357268 |
accaaacttccctgcagattgtgatcgtttagcagttgccggagatgaaaatctcttaggcgttggtaaattatctcgtggagcaagtggttgccgtgaa |
46357169 |
T |
|
| Q |
208 |
tgaacattgttgatctt------------------gatctgaatgggagattgtgcggaggttgtgttggtggagagatacaaagaaagaggatcatctg |
289 |
Q |
| |
|
||||||||||||||||| |||||||| |||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46357168 |
tgaacattgttgatcttctgttgttgttgttgattgatctgaaccggagattgtgg------tgtgttggtggagagatacaaagaaagaggatcatctg |
46357075 |
T |
|
| Q |
290 |
aatctgataatggttgaatagtgaaatgacgagtggtaggtgaaatacgagctacaagtggttctggtgttccgacgaaggaatgacgagtgggtagagg |
389 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46357074 |
aatctgataatggttgaatggtgaaatgacgagtggtaggtgaaatacgagctacaagtggttctggtgttccgacgaaggaatgacgagtgggtagagg |
46356975 |
T |
|
| Q |
390 |
acgaatgttggtgacagaaggaagaggggaatggaaatggaagcgatcaacgtagaggaattgacctagctgaagacggttattgaggatgagatcggtg |
489 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||| ||||||||||||||||||||| |
|
|
| T |
46356974 |
acgaatgttggtgacagaaggaagaggggaatggaaatggaagcgatcaacgtagaggaattggcctaattgaagacgattattgaggatgagatcggtg |
46356875 |
T |
|
| Q |
490 |
tcagggtgagagagaagaacgtaggtggagttgagagaatcaga |
533 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46356874 |
tcagggtgagagagaagaacgtaggtggagttgagagaatcaga |
46356831 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 14590 times since January 2019
Visitors: 8422