View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1311_low_22 (Length: 264)
Name: NF1311_low_22
Description: NF1311
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1311_low_22 |
| |
|
Alignment Details
Target: chr4 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 1 - 235
Target Start/End: Complemental strand, 52465178 - 52464956
Alignment:
Q |
1 |
ttgtatgtcgacagaactatacagtacaccaacaagtgggtcaagatattttgttctgatgaagagacgtgataacgtgataacgtgatatttctcccat |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
T |
52465178 |
ttgtatgtcgacagaactatacagtacaccaacaagtgggtcaagatattttgttctgatgaagagacgtgataacgtgata--------tttctcccat |
52465087 |
T |
|
Q |
101 |
gttacagtgttcattgacagtgttataagtaagctttcatatctctcactcaccaaactaccaacaacctcaactacaagatgactgacaccatagcagc |
200 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
52465086 |
gttacagtgttcattgacagtgttataagtaagctttcatatctctcac----caaactaccaacaacctcaactacaagatgactgacaccatagcagc |
52464991 |
T |
|
Q |
201 |
aagtaataatttcatagctacattcatgtggttca |
235 |
Q |
|
|
||||||||||||||||||||||||||||||||||| |
|
|
T |
52464990 |
aagtaataatttcatagctacattcatgtggttca |
52464956 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 10300 times since January 2019
Visitors: 7976