View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1312-Insertion-2 (Length: 73)
Name: NF1312-Insertion-2
Description: NF1312
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1312-Insertion-2 |
 | |
|
| [»] scaffold0020 (1 HSPs) |
| |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: scaffold0020 (Bit Score: 62; Significance: 2e-27; HSPs: 1)
Name: scaffold0020
Description:
Target: scaffold0020; HSP #1
Raw Score: 62; E-Value: 2e-27
Query Start/End: Original strand, 8 - 73
Target Start/End: Complemental strand, 135666 - 135601
Alignment:
| Q |
8 |
attatgtgatgcgaaggtggttgattcagttcatcacgaaaatagtttagatggtgcgctctggga |
73 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
135666 |
attatgtgatgcgaaggtggttgattcagttcatcacgaaaatagtttagatggtgctctctggga |
135601 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 50; Significance: 2e-20; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 50; E-Value: 2e-20
Query Start/End: Original strand, 12 - 73
Target Start/End: Complemental strand, 20866918 - 20866857
Alignment:
| Q |
12 |
tgtgatgcgaaggtggttgattcagttcatcacgaaaatagtttagatggtgcgctctggga |
73 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||| | |||||| |
|
|
| T |
20866918 |
tgtgatgcgaaggtggttgattcagttcatcaagaaaatagtttagatggtgctcactggga |
20866857 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 13129 times since January 2019
Visitors: 8270