View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1312_high_18 (Length: 262)
Name: NF1312_high_18
Description: NF1312
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1312_high_18 |
| |
|
[»] chr8 (6 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 227; Significance: 1e-125; HSPs: 6)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 28 - 262
Target Start/End: Complemental strand, 8946864 - 8946630
Alignment:
Q |
28 |
cagccggaaatcaagttgatggtgcatctttctttggttatgcaaatggaacggcaaggggaatagctacattgtctagagtgtctatgtacaagattgt |
127 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
8946864 |
cagccggaaatcaagttgatggtgcatctttctttggttatgcaaatggaacggcaaggggaatagctacattgtctagagtgtctatgtacaagattgt |
8946765 |
T |
|
Q |
128 |
gtggggacaaaatgaagatccgattgcaatttcatctgatataatggctgcaattgatgccgcaatatcggacggtgttgatgttctttcgatttcatta |
227 |
Q |
|
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
T |
8946764 |
gtggggacaaaatgaagatccaattgcaatttcatctgatataatggctgcaattgatgctgcaatatcggacggtgttgatgttctttcgatttcatta |
8946665 |
T |
|
Q |
228 |
ggtccaacttttgatttacctttgaatgaagatcc |
262 |
Q |
|
|
||||||||||||||||||||||||||||||||||| |
|
|
T |
8946664 |
ggtccaacttttgatttacctttgaatgaagatcc |
8946630 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 36 - 230
Target Start/End: Original strand, 8973639 - 8973827
Alignment:
Q |
36 |
aatcaagttgatggtgcatctttctttggttatgcaaatggaacggcaaggggaatagctacattgtctagagtgtctatgtacaagattgtgtggggac |
135 |
Q |
|
|
|||||||||||||||||||| ||||||||||||||||| ||||| ||||| ||||||||||||||||||||||| |||||||||||| || |||||| |
|
|
T |
8973639 |
aatcaagttgatggtgcatcattctttggttatgcaaacggaacagcaagaggaatagctacattgtctagagtagctatgtacaagactgcgtggggca |
8973738 |
T |
|
Q |
136 |
aaaatgaagatccgattgcaatttcatctgatataatggctgcaattgatgccgcaatatcggacggtgttgatgttctttcgatttcattaggt |
230 |
Q |
|
|
|| ||| | | |||| | |||||||||||||| || ||| |||||||| |||||||||||||||||||||||||||| || ||| ||||| |
|
|
T |
8973739 |
aagatggaca------tgcagtgtcatctgatataatagccgcagttgatgcctcaatatcggacggtgttgatgttctttcaatatcactaggt |
8973827 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 157 - 229
Target Start/End: Original strand, 8962355 - 8962427
Alignment:
Q |
157 |
tttcatctgatataatggctgcaattgatgccgcaatatcggacggtgttgatgttctttcgatttcattagg |
229 |
Q |
|
|
|||||||||| | ||| ||||||||||||||||||||||| |||||||| ||||||||||| || |||||||| |
|
|
T |
8962355 |
tttcatctgacacaatagctgcaattgatgccgcaatatcagacggtgtggatgttctttcaatatcattagg |
8962427 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 34 - 125
Target Start/End: Complemental strand, 9950170 - 9950079
Alignment:
Q |
34 |
gaaatcaagttgatggtgcatctttctttggttatgcaaatggaacggcaaggggaatagctacattgtctagagtgtctatgtacaagatt |
125 |
Q |
|
|
||||||||||||||||||||| |||||||||||||| |||| |||| ||| | |||| ||||||||||||||| |||||||||||||| |
|
|
T |
9950170 |
gaaatcaagttgatggtgcatttttctttggttatgtaaatcgaactacaaaagaaataattacattgtctagagtagctatgtacaagatt |
9950079 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 159 - 217
Target Start/End: Original strand, 8957346 - 8957404
Alignment:
Q |
159 |
tcatctgatataatggctgcaattgatgccgcaatatcggacggtgttgatgttctttc |
217 |
Q |
|
|
||||||||| |||| || |||||||| || |||||||| |||||||||||||||||||| |
|
|
T |
8957346 |
tcatctgatgtaatagccgcaattgacgcggcaatatcagacggtgttgatgttctttc |
8957404 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 36 - 94
Target Start/End: Original strand, 8962237 - 8962295
Alignment:
Q |
36 |
aatcaagttgatggtgcatctttctttggttatgcaaatggaacggcaaggggaatagc |
94 |
Q |
|
|
||||| ||| |||||||||| ||||| ||||||||||||||||| ||||| |||||||| |
|
|
T |
8962237 |
aatcaggttaatggtgcatcattcttcggttatgcaaatggaacagcaagaggaatagc |
8962295 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 71; Significance: 3e-32; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 40 - 217
Target Start/End: Complemental strand, 21687991 - 21687820
Alignment:
Q |
40 |
aagttgatggtgcatctttctttggttatgcaaatggaacggcaaggggaatagctacattgtctagagtgtctatgtacaagattgtgtggggacaaaa |
139 |
Q |
|
|
||||||||||||||||||||||||| |||||||||||||| ||||| || |||||| ||| ||||||||| |||| ||||||| || ||||||| || | |
|
|
T |
21687991 |
aagttgatggtgcatctttctttggctatgcaaatggaacagcaagaggtatagcttcatcgtctagagtagctatatacaagactgcgtggggaaaaga |
21687892 |
T |
|
Q |
140 |
tgaagatccgattgcaatttcatctgatataatggctgcaattgatgccgcaatatcggacggtgttgatgttctttc |
217 |
Q |
|
|
|| ||| ||| |||||||||||||||| |||||||||||||| |||||||| ||||||||||| ||||||| |
|
|
T |
21687891 |
tggaga------cgcactttcatctgatataatagctgcaattgatgctgcaatatctgacggtgttgacattctttc |
21687820 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 160 - 217
Target Start/End: Complemental strand, 34963494 - 34963437
Alignment:
Q |
160 |
catctgatataatggctgcaattgatgccgcaatatcggacggtgttgatgttctttc |
217 |
Q |
|
|
|||||||| |||| ||||||||||| || |||||||| |||||||| |||||| |||| |
|
|
T |
34963494 |
catctgatgtaatagctgcaattgacgctgcaatatccgacggtgtcgatgttatttc |
34963437 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 9906 times since January 2019
Visitors: 7932