View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1312_high_4 (Length: 507)
Name: NF1312_high_4
Description: NF1312
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1312_high_4 |
| |
|
Alignment Details
Target: chr8 (Bit Score: 254; Significance: 1e-141; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 254; E-Value: 1e-141
Query Start/End: Original strand, 1 - 358
Target Start/End: Original strand, 3683913 - 3684271
Alignment:
Q |
1 |
tgttgatcctcattgctcagatactatgtgcttgtcaatcaaacaagatgttttcccattttcacatttttt-gtttagcaaatatttatggtcgaaata |
99 |
Q |
|
|
||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||| |||||||||||||| ||||||||||||||||||||||||||| |
|
|
T |
3683913 |
tgttgatcctcattgctcagatactctgtgcttgtcaatcaaataagatgttttccctttttcacatttttttgtttagcaaatatttatggtcgaaata |
3684012 |
T |
|
Q |
100 |
ttgaatcaagtaattttttgt---ctatagttcattttctcttctaaaactcacgtgttttcttagcagtttctcctaaataggatttcaactagagtta |
196 |
Q |
|
|
|||||||| |||||||||| | ||||||||||||||||||||||||||||||| |||||||| |||||||||||||||| ||||||||||||||||| |
|
|
T |
3684013 |
ttgaatcaggtaatttttttttttctatagttcattttctcttctaaaactcacgcattttcttatcagtttctcctaaataagatttcaactagagtta |
3684112 |
T |
|
Q |
197 |
atttgt--aggcgcagagttatcactgatcctgctagtgcctcttgtgccatgtaggggtctctttcgagtcaactaatcacttttttatgttttgtgtg |
294 |
Q |
|
|
|||||| |||||||| |||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||| |
|
|
T |
3684113 |
atttgttaaggcgcagggttatcaccgatcctgctagtgcctcttgtgccatgtaggggtctcttccgagtcaactaatcac-tttttatgttttgtgtg |
3684211 |
T |
|
Q |
295 |
gggtggcctctacgtacggtttggcataggattctagatggttatggtggaagtggattttgct |
358 |
Q |
|
|
|||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
T |
3684212 |
gggtggcctc----tacggtttggcatatgattctagatggttatggtggaagtggattttgct |
3684271 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 354 - 396
Target Start/End: Complemental strand, 24191687 - 24191645
Alignment:
Q |
354 |
ttgctttgtagtcttgctccgttcgtgaggttcgttccggttc |
396 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
24191687 |
ttgctttgtagtcttgctccgttcgtgaggttcgttccggttc |
24191645 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 83; Significance: 4e-39; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 83; E-Value: 4e-39
Query Start/End: Original strand, 354 - 440
Target Start/End: Original strand, 44499518 - 44499604
Alignment:
Q |
354 |
ttgctttgtagtcttgctccgttcgtgaggttcgttccggttcggtcttgttgttgtaaaaatgaaggaggatgagaagacaaaagg |
440 |
Q |
|
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
44499518 |
ttgctttgtagtcctgctccgttcgtgaggttcgttccggttcggtcttgttgttgtaaaaatgaaggaggatgagaagacaaaagg |
44499604 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 392 - 433
Target Start/End: Complemental strand, 39057113 - 39057072
Alignment:
Q |
392 |
ggttcggtcttgttgttgtaaaaatgaaggaggatgagaaga |
433 |
Q |
|
|
|||||||||||||||| || |||||||||||||| ||||||| |
|
|
T |
39057113 |
ggttcggtcttgttgtcgtgaaaatgaaggaggaagagaaga |
39057072 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 75; Significance: 3e-34; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 75; E-Value: 3e-34
Query Start/End: Original strand, 354 - 440
Target Start/End: Original strand, 44376268 - 44376354
Alignment:
Q |
354 |
ttgctttgtagtcttgctccgttcgtgaggttcgttccggttcggtcttgttgttgtaaaaatgaaggaggatgagaagacaaaagg |
440 |
Q |
|
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||| |
|
|
T |
44376268 |
ttgctttgtagtcttgctctgttcgtgaggttcgttccggttcggtcttgttgtcgtaaaaatgaaggaggatgagaaaacaaaagg |
44376354 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 75; E-Value: 3e-34
Query Start/End: Original strand, 354 - 440
Target Start/End: Original strand, 44385135 - 44385221
Alignment:
Q |
354 |
ttgctttgtagtcttgctccgttcgtgaggttcgttccggttcggtcttgttgttgtaaaaatgaaggaggatgagaagacaaaagg |
440 |
Q |
|
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||| |
|
|
T |
44385135 |
ttgctttgtagtcttgctctgttcgtgaggttcgttccggttcggtcttgttgtcgtaaaaatgaaggaggatgagaaaacaaaagg |
44385221 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 9156 times since January 2019
Visitors: 7893