View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1312_low_24 (Length: 292)
Name: NF1312_low_24
Description: NF1312
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1312_low_24 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 11 - 263
Target Start/End: Complemental strand, 30737616 - 30737371
Alignment:
| Q |
11 |
cacagacatgacttattatgcttgggtcaaggcataatttaacatg-atgtatataaaacatctatgatgcttcttttgtattggaggcttccaatagat |
109 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||| |||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
30737616 |
cacagacatgacttattatgcttgagtcaaggcataagttaacatggatgtatataaaacatctatgatacttcttttgtattggaggcttccaatagat |
30737517 |
T |
|
| Q |
110 |
tttgtgtccttgcttcaatgatgaattcattgcatagtgtttacatcgagagatgtaagttggctcggatgtatttaaaacattcgagaccaggcatttt |
209 |
Q |
| |
|
|| ||||||||||||||| |||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30737516 |
ttcgtgtccttgcttcaaggatgaattcattccatagtgtttac--------atgtaagttggctcggatgtatttaaaacattcgagaccaggcatttt |
30737425 |
T |
|
| Q |
210 |
tctacaaatgctcgacttggtttttactgaattaaaccaatgatggggtagagg |
263 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
30737424 |
tctacaaatgctcgacttggtttttcctgaattaaaccaatgatggggtagagg |
30737371 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 10228 times since January 2019
Visitors: 7975