View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1312_low_33 (Length: 218)
Name: NF1312_low_33
Description: NF1312
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1312_low_33 |
| |
|
Alignment Details
Target: chr5 (Bit Score: 141; Significance: 4e-74; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 141; E-Value: 4e-74
Query Start/End: Original strand, 1 - 141
Target Start/End: Complemental strand, 2628764 - 2628624
Alignment:
Q |
1 |
catacaggacacgaggcacaaatgtaagaagctatgtactgtgtttggtttggccaccaccaaccaggcatcaaaaatggcaataaccttattgccaatc |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
2628764 |
catacaggacacgaggcacaaatgtaagaagctatgtactgtgtttggtttggccaccaccaaccaggcatcaaaaatggcaataaccttattgccaatc |
2628665 |
T |
|
Q |
101 |
ttctctgacattagtgtctgatgaggccaagacaccatatt |
141 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
2628664 |
ttctctgacattagtgtctgatgaggccaagacaccatatt |
2628624 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 11122 times since January 2019
Visitors: 8059