View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1317A-Insertion-26 (Length: 135)
Name: NF1317A-Insertion-26
Description: NF1317A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1317A-Insertion-26 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 63; Significance: 9e-28; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 63; E-Value: 9e-28
Query Start/End: Original strand, 8 - 108
Target Start/End: Original strand, 6994896 - 6994997
Alignment:
| Q |
8 |
gtatcttaatgcacacacattcgaaagaataaccaaataaatactacaggttccct-nnnnnnnnntatactagcagtatttaggttagatatgtttttg |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
6994896 |
gtatcttaatgcacacacattcgaaagaataaccaaataaatactactggttccctaaaaaaaaaatatactagcagtatttaggttagatatgtttttg |
6994995 |
T |
|
| Q |
107 |
tt |
108 |
Q |
| |
|
|| |
|
|
| T |
6994996 |
tt |
6994997 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 39; E-Value: 0.0000000000002
Query Start/End: Original strand, 97 - 135
Target Start/End: Original strand, 6995011 - 6995049
Alignment:
| Q |
97 |
tatgtttttgttcctaacaaaatatctctccctcaattg |
135 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6995011 |
tatgtttttgttcctaacaaaatatctctccctcaattg |
6995049 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 16073 times since January 2019
Visitors: 3757