View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1317A-Insertion-28 (Length: 134)
Name: NF1317A-Insertion-28
Description: NF1317A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1317A-Insertion-28 |
 | |
|
| [»] chr4 (2 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 33; Significance: 0.0000000007; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.0000000007
Query Start/End: Original strand, 102 - 134
Target Start/End: Complemental strand, 24984126 - 24984094
Alignment:
| Q |
102 |
gataaacaaatgttagtacgttaatagttatgt |
134 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
24984126 |
gataaacaaatgttagtacgttaatagttatgt |
24984094 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 33; E-Value: 0.0000000007
Query Start/End: Original strand, 8 - 40
Target Start/End: Complemental strand, 24984218 - 24984186
Alignment:
| Q |
8 |
gatgcctctagaaaagacttgttgtattttcta |
40 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
24984218 |
gatgcctctagaaaagacttgttgtattttcta |
24984186 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 12624 times since January 2019
Visitors: 8222