View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1317A-Insertion-9 (Length: 465)
Name: NF1317A-Insertion-9
Description: NF1317A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1317A-Insertion-9 |
 | |
|
| [»] chr3 (3 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 395; Significance: 0; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 395; E-Value: 0
Query Start/End: Original strand, 28 - 465
Target Start/End: Original strand, 37587874 - 37588312
Alignment:
| Q |
28 |
actttcacatgtttccaattagatacgttactgattttgagttagaacttgatttccaattagataccattactttctccatacattggtaattgctagc |
127 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37587874 |
actttcacatgtttccaattagatacgttactgattttgagttagaacttgatttccaattagataccattactttctccatacattggtaattgctagc |
37587973 |
T |
|
| Q |
128 |
gatatccgtatactgattttgagttagaaaactctactccccttgttttatgactaactaatactttttgaacgattttccttctcttcggccaaatttg |
227 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||| || |
|
|
| T |
37587974 |
gatatccatatactgattttgagttagaaaactctactccgcttgttttatgactaactaatactttttgaacgattttccttcttttcggccaaatctg |
37588073 |
T |
|
| Q |
228 |
gaatactagtattttttgactc-actcttttgctagaaacctaacttcattgtgttttttatcctttgagatttgcctttgatgatagaaacaacttcta |
326 |
Q |
| |
|
|||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37588074 |
gaatactagtattttttgactctaatcttttgctagaaacctaacttcattgtgttttttatcctttgagatttgcctttgatgatagaaacaacttcta |
37588173 |
T |
|
| Q |
327 |
tattgcctttgatttactcttacccttcttttattttatgctgagttcaactttttacaggaggaaatacactgttattgatagtttctgccatttttct |
426 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||| |||||||||| ||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37588174 |
tattgcctttgatttactcttacccttcttttattttatggtgagtttaactttttaccggaagaaatacactgttattgatagtttctgccatttttct |
37588273 |
T |
|
| Q |
427 |
tctactgtcagatttctatctattgtgaacatatagttt |
465 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37588274 |
tctactgtcagatttctatctattgtgaacatatagttt |
37588312 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 402 - 458
Target Start/End: Original strand, 33722010 - 33722065
Alignment:
| Q |
402 |
tattgatagtttctgccatttttcttctactgtcagatttctatctattgtgaacat |
458 |
Q |
| |
|
|||||||||||||||| ||||||||| || ||||||||||||||||||||||||||| |
|
|
| T |
33722010 |
tattgatagtttctgctatttttctttta-tgtcagatttctatctattgtgaacat |
33722065 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 180 - 243
Target Start/End: Original strand, 37583191 - 37583254
Alignment:
| Q |
180 |
actaactaatactttttgaacgattttccttctcttcggccaaatttggaatactagtattttt |
243 |
Q |
| |
|
|||| ||||||||| ||||| |||||||||||| || |||||||||||||||||||||||||| |
|
|
| T |
37583191 |
actagctaatacttattgaaagattttccttcttgtctgccaaatttggaatactagtattttt |
37583254 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 11489 times since January 2019
Visitors: 8091