View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1381_high_13 (Length: 274)
Name: NF1381_high_13
Description: NF1381
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1381_high_13 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 154; Significance: 9e-82; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 154; E-Value: 9e-82
Query Start/End: Original strand, 70 - 239
Target Start/End: Complemental strand, 506414 - 506245
Alignment:
| Q |
70 |
gcaataccatagacaaatatgataaaccaattatcctaactaagttttatgtttgcatttgcagttcaataattgaacaatttgctagcacagtttccaa |
169 |
Q |
| |
|
|||||||||||||||||| || ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
506414 |
gcaataccatagacaaatgtggtaaaccaattatcctaactaacttttatgtttgcatttgcagttcaataattgaacaatttgctaccacagtttccaa |
506315 |
T |
|
| Q |
170 |
ccttgcacaaatattagctaatatcctagcagagaaattgggtcaccaatcatctttctttaaggagaat |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
506314 |
ccttgcacaaatattagctaatatcctagcagagaaattgggtcaccaatcatctttctttaaggagaat |
506245 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 33; Significance: 0.000000002; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 127 - 239
Target Start/End: Complemental strand, 16703181 - 16703069
Alignment:
| Q |
127 |
tttgcagttcaataattgaacaatttgctagcacagtttccaaccttgcacaaatattagctaatatcctagcagagaaattgggtcaccaatcatcttt |
226 |
Q |
| |
|
||||||| |||| ||||||||||||||||| || | |||||||||||||||| |||||| |||| ||||| || ||| |||| || ||||| ||| |
|
|
| T |
16703181 |
tttgcagatcaacaattgaacaatttgctatcatatcatccaaccttgcacaaactttagctcatattctagctgaaaaaatggggcatgaatcaactta |
16703082 |
T |
|
| Q |
227 |
ctttaaggagaat |
239 |
Q |
| |
|
|||||||||||| |
|
|
| T |
16703081 |
ttttaaggagaat |
16703069 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 127 - 239
Target Start/End: Complemental strand, 17677417 - 17677305
Alignment:
| Q |
127 |
tttgcagttcaataattgaacaatttgctagcacagtttccaaccttgcacaaatattagctaatatcctagcagagaaattgggtcaccaatcatcttt |
226 |
Q |
| |
|
||||||| |||| ||||||||||||||||| || | |||||||||||||||| |||||| |||| ||||| || ||| |||| || ||||| ||| |
|
|
| T |
17677417 |
tttgcagatcaacaattgaacaatttgctatcatatcatccaaccttgcacaaactttagctcatattctagctgaaaaaatggggcatgaatcaactta |
17677318 |
T |
|
| Q |
227 |
ctttaaggagaat |
239 |
Q |
| |
|
|||||||||||| |
|
|
| T |
17677317 |
ttttaaggagaat |
17677305 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 12435 times since January 2019
Visitors: 8218