View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1381_low_21 (Length: 265)
Name: NF1381_low_21
Description: NF1381
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1381_low_21 |
 | |
|
| [»] scaffold0229 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0229 (Bit Score: 107; Significance: 1e-53; HSPs: 1)
Name: scaffold0229
Description:
Target: scaffold0229; HSP #1
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 99 - 236
Target Start/End: Original strand, 18868 - 19006
Alignment:
| Q |
99 |
agatcgattggtgattgagccgtgcggcnnnnnnnn-atcataaatgataatgatctctagagttttggagagaataacaaaacaaagtcaacaagtaat |
197 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18868 |
agatcgattggtgattgagccgtgcggctttttttttatcataaatgataatgatctctagagttttggagagaataacaaaacaaagtcaacaagtaat |
18967 |
T |
|
| Q |
198 |
caaggaagcaacgatcatcaaagcaacatattcctatga |
236 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18968 |
caaggaagcaacgatcatcaaagcaacatattcctatga |
19006 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 107; Significance: 1e-53; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 99 - 236
Target Start/End: Complemental strand, 1399490 - 1399352
Alignment:
| Q |
99 |
agatcgattggtgattgagccgtgcggcnnnnnnnn-atcataaatgataatgatctctagagttttggagagaataacaaaacaaagtcaacaagtaat |
197 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1399490 |
agatcgattggtgattgagccgtgcggctttttttttatcataaatgataatgatctctagagttttggagagaataacaaaacaaagtcaacaagtaat |
1399391 |
T |
|
| Q |
198 |
caaggaagcaacgatcatcaaagcaacatattcctatga |
236 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1399390 |
caaggaagcaacgatcatcaaagcaacatattcctatga |
1399352 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 14176 times since January 2019
Visitors: 8375