View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1381_low_37 (Length: 208)
Name: NF1381_low_37
Description: NF1381
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1381_low_37 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 81; Significance: 3e-38; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 111 - 207
Target Start/End: Original strand, 39793435 - 39793531
Alignment:
| Q |
111 |
ccctgcaacaggtttgtttctactttccacaaaaaggggactgagcacaacaaaagatcccatcatacgaagtggtaggttgccaagaaaaccctac |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||| |||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
39793435 |
ccctgcaacaggtttgtttctactttccacaaaaatgggactgagcacaactaaagataccatcatacgaagtggtaggttgccaagaaaaacctac |
39793531 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 11235 times since January 2019
Visitors: 8059