View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1381_low_38 (Length: 203)
Name: NF1381_low_38
Description: NF1381
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1381_low_38 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 61; Significance: 2e-26; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 57 - 117
Target Start/End: Original strand, 48569141 - 48569201
Alignment:
| Q |
57 |
gaaatcttgcagtgtgctgagtctgcattgaaatcagtcataggagatctctccaatacct |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48569141 |
gaaatcttgcagtgtgctgagtctgcattgaaatcagtcataggagatctctccaatacct |
48569201 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 32; Significance: 0.000000004; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 63 - 122
Target Start/End: Complemental strand, 10821937 - 10821878
Alignment:
| Q |
63 |
ttgcagtgtgctgagtctgcattgaaatcagtcataggagatctctccaatacctatttt |
122 |
Q |
| |
|
||||||||||| || ||||| |||||||||||| |||||||||| || ||||| |||||| |
|
|
| T |
10821937 |
ttgcagtgtgcagaatctgccttgaaatcagtcttaggagatctttcgaatacatatttt |
10821878 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 10277 times since January 2019
Visitors: 7975