View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1381_low_7 (Length: 354)
Name: NF1381_low_7
Description: NF1381
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1381_low_7 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 151; Significance: 8e-80; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 151; E-Value: 8e-80
Query Start/End: Original strand, 96 - 254
Target Start/End: Complemental strand, 30354699 - 30354541
Alignment:
| Q |
96 |
tttttaccctgtaattttcttcttcttcccacgttccatcaaaaccttatatttacctttctcttcttcatgtttctcttctttttattgggttttgaat |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
30354699 |
tttttaccctgtaattttcttcttcttcccacgttccatcaaaaccttatatttacctttctcttcttcatgtttctcttctttttattggattttgaat |
30354600 |
T |
|
| Q |
196 |
tgagttaagagttttttcctccaaaattgtgtttgtttgttctaaaaagtataatggcg |
254 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30354599 |
tgagttaagagtttttttctccaaaattgtgtttgtttgttctaaaaagtataatggcg |
30354541 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 8459 times since January 2019
Visitors: 7803