View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1381_low_9 (Length: 333)

Name: NF1381_low_9
Description: NF1381
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1381_low_9
NF1381_low_9
[»] chr8 (2 HSPs)
chr8 (115-322)||(43543429-43543642)
chr8 (30-70)||(43543370-43543410)


Alignment Details
Target: chr8 (Bit Score: 187; Significance: 1e-101; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 115 - 322
Target Start/End: Original strand, 43543429 - 43543642
Alignment:
115 catgtcgatgatattgagggcatggaattggtatcagaatagcctctccgttcatccggtgagaacccaagtcgccacctccggcgtcctttgggccgtt 214  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43543429 catgtcgatgatattgagggcatggaattggtatcagaatagcctctccgttcatccggtgagaacccaagtcgccacctccggcgtcctttgggccgtt 43543528  T
215 ggagatgtcactgctcagtacatcactcattcggcagctg------catcttctaaaaagcgtcttcagttatctgccactgtatgtcttttagcactac 308  Q
    |||||||||||||||||||||||||||||||| |||||||      ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43543529 ggagatgtcactgctcagtacatcactcattcagcagctgcatcttcatcttctaaaaagcgtcttcagttatctgccactgtatgtcttttagcactac 43543628  T
309 ccatctctctctct 322  Q
    ||||||||||||||    
43543629 ccatctctctctct 43543642  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 30 - 70
Target Start/End: Original strand, 43543370 - 43543410
Alignment:
30 agacactggtctaatatccaacgagaaccaccgaattaatc 70  Q
    ||||||||||||||||||||||||||| |||||||||||||    
43543370 agacactggtctaatatccaacgagaagcaccgaattaatc 43543410  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 9058 times since January 2019
Visitors: 7893