View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1390-INSERTION-12 (Length: 419)
Name: NF1390-INSERTION-12
Description: NF1390
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1390-INSERTION-12 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 212; Significance: 1e-116; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 60 - 275
Target Start/End: Original strand, 48763245 - 48763460
Alignment:
| Q |
60 |
ttgatatcaaatgcgatgtgtctaatatttttcacacatcactcgtggttaggacagaacatgggctaaaaacaatcatacaccctgttaataaataaag |
159 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48763245 |
ttgatatcaaatgcgatgcgtctaatatttttcacacatcactcgtggttaggacagaacatgggctaaaaacaatcatacaccctgttaataaataaag |
48763344 |
T |
|
| Q |
160 |
tgattgtcgtggtatctgcaaatcgcacttgcaagttgcaagtttaaatataattttaattcctaaaaattggtgcatttcctacggtcaataacagacc |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48763345 |
tgattgtcgtggtatctgcaaatcgcacttgcaagttgcaagtttaaatataattttaattcctaaaaattggtgcatttcctacggtcaataacagacc |
48763444 |
T |
|
| Q |
260 |
gtaaaccatatgtcag |
275 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
48763445 |
gtaaaccatatgtcag |
48763460 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 343 - 419
Target Start/End: Original strand, 48763528 - 48763604
Alignment:
| Q |
343 |
gagtttgtactaatgataaaaagacaaatcgattcagagagtctcgagttagaatcttgcctaaggtgttttctatc |
419 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48763528 |
gagtttgtactaatgataaaaagacaaatcgattcagagagtctcgagttagaatcttgcctaaggtgttttctatc |
48763604 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 8 - 52
Target Start/End: Original strand, 48763062 - 48763106
Alignment:
| Q |
8 |
atccatttactctatctacctcatagctcctcaacagctaaaaaa |
52 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48763062 |
atccatttactctatctacctcatagctcctcaacagctaaaaaa |
48763106 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 7909 times since January 2019
Visitors: 7737