View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1390-Insertion-15 (Length: 451)
Name: NF1390-Insertion-15
Description: NF1390
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1390-Insertion-15 |
| |
|
[»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 413; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 413; E-Value: 0
Query Start/End: Original strand, 8 - 451
Target Start/End: Original strand, 39227388 - 39227825
Alignment:
Q |
8 |
ggtaggtgcatgcagagcggtagcagcaccacccatttcccatcttccgttgcgaaatcctaaaaccgtcagaattaagaattcttgtcatcagaacaaa |
107 |
Q |
|
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
T |
39227388 |
ggtaggtgcatgcagagcagtagcagcaccacccatttcccatcttccgttgcgaaatcctaaaaccatcagaattaagaattcttgtcatcagaacaaa |
39227487 |
T |
|
Q |
108 |
accaaagctttcagagctcaactttcaaatagacgcttgttccttttctctattcccctctctagtttcattttccttccttttcctgcgttttgtgaag |
207 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
39227488 |
accaaagctttcagagctcaactttcaaatagacgcttgttccttttctctattcccctctctagtttcattttccttccttttcctgcgttttgtgaag |
39227587 |
T |
|
Q |
208 |
gtgacagtgacagtgtcatttcacaagagtatgacccggtaactcgttctgaaagagatgcaagtgctttaatctcacaaagagtttctcgtggtgttga |
307 |
Q |
|
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
39227588 |
gtga------cagtgtcatttcacaagagtatgacccggtaactcgttctgaaagagatgcaagtgctttaatctcacaaagagtttctcgtggtgttga |
39227681 |
T |
|
Q |
308 |
gttgttggagaaaggtagagagttgcaggctcttggtgacttcaatggcgctcttcaatacttttctcaggttacccaatatcctttcattaggttcttg |
407 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
39227682 |
gttgttggagaaaggtagagagttgcaggctcttggtgacttcaatggcgctcttcaatacttttctcaggttacccaatatcctttcattaggttcttg |
39227781 |
T |
|
Q |
408 |
cttgtttatcttcaattcggtaatggattattggattgctcttg |
451 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
39227782 |
cttgtttatcttcaattcggtaatggattattggattgctcttg |
39227825 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 11336 times since January 2019
Visitors: 8091