View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1390-Insertion-24 (Length: 157)
Name: NF1390-Insertion-24
Description: NF1390
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1390-Insertion-24 |
 | |
|
| [»] chr3 (3 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 139; Significance: 5e-73; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 139; E-Value: 5e-73
Query Start/End: Original strand, 7 - 157
Target Start/End: Complemental strand, 38184249 - 38184099
Alignment:
| Q |
7 |
agcatttccccagtggacagatcaaactactaatgcaaagttaattgaagatttgtggaagattggggtgaggatggaacgtgatgaggaagcaggtata |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||| |||||||||||||||||||||||||| |
|
|
| T |
38184249 |
agcatttccccagtggacagatcaaactactaatgcaaagttaattgaagatttgtggaagactgggttgagggtggaacgtgatgaggaagcaggtata |
38184150 |
T |
|
| Q |
107 |
gtgaaagctggggaaattatgaagtgtttggaagtggtgatggggaaggga |
157 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38184149 |
gtgaaagctggggaaattatgaagtgtttggaagtggtgatggggaaggga |
38184099 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 92; E-Value: 5e-45
Query Start/End: Original strand, 8 - 157
Target Start/End: Complemental strand, 38179579 - 38179433
Alignment:
| Q |
8 |
gcatttccccagtggacagatcaaactactaatgcaaagttaattgaagatttgtggaagattggggtgaggatggaacgtgatgaggaagcaggtatag |
107 |
Q |
| |
|
|||||||| ||||||||||||||||| |||||||||||||||||||||||| ||||||||| |||||||||||||||| |||||||||| ||| || | |
|
|
| T |
38179579 |
gcatttcctcagtggacagatcaaaccactaatgcaaagttaattgaagatgtgtggaagactggggtgaggatggaatgtgatgagga---agggatgg |
38179483 |
T |
|
| Q |
108 |
tgaaagctggggaaattatgaagtgtttggaagtggtgatggggaaggga |
157 |
Q |
| |
|
||||||||| |||||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
38179482 |
tgaaagctgaggaaattagaaagtgttttgaagtggtgatggggaaggga |
38179433 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 84; E-Value: 3e-40
Query Start/End: Original strand, 8 - 157
Target Start/End: Complemental strand, 38169765 - 38169619
Alignment:
| Q |
8 |
gcatttccccagtggacagatcaaactactaatgcaaagttaattgaagatttgtggaagattggggtgaggatggaacgtgatgaggaagcaggtatag |
107 |
Q |
| |
|
|||||||| ||||||||||||||||| |||||||| ||||||||||||||| ||||||||| |||| |||||||||||| ||||||||| ||| || | |
|
|
| T |
38169765 |
gcatttcctcagtggacagatcaaaccactaatgcgaagttaattgaagatgtgtggaagactgggttgaggatggaacatgatgagga---agggatgg |
38169669 |
T |
|
| Q |
108 |
tgaaagctggggaaattatgaagtgtttggaagtggtgatggggaaggga |
157 |
Q |
| |
|
|||||| || |||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
38169668 |
tgaaagttgaggaaattagaaagtgtttggaagtggtgatggggaaggga |
38169619 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 35; Significance: 0.00000000005; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 35; E-Value: 0.00000000005
Query Start/End: Original strand, 11 - 69
Target Start/End: Original strand, 35054182 - 35054240
Alignment:
| Q |
11 |
tttccccagtggacagatcaaactactaatgcaaagttaattgaagatttgtggaagat |
69 |
Q |
| |
|
||||| || ||||||||||| | |||||||||||||||||||||||| |||||||||| |
|
|
| T |
35054182 |
tttccacaatggacagatcagatgactaatgcaaagttaattgaagatgtgtggaagat |
35054240 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 35; E-Value: 0.00000000005
Query Start/End: Original strand, 8 - 78
Target Start/End: Original strand, 35060917 - 35060987
Alignment:
| Q |
8 |
gcatttccccagtggacagatcaaactactaatgcaaagttaattgaagatttgtggaagattggggtgag |
78 |
Q |
| |
|
|||||||| || ||||| ||||||| ||||||||||| ||||||||||| |||||||||| |||||||| |
|
|
| T |
35060917 |
gcatttcctcaatggactgatcaaaagactaatgcaaaactaattgaagatgtgtggaagataggggtgag |
35060987 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 9588 times since January 2019
Visitors: 7931