View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1390-Insertion-28 (Length: 167)
Name: NF1390-Insertion-28
Description: NF1390
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1390-Insertion-28 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 120; Significance: 1e-61; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 120; E-Value: 1e-61
Query Start/End: Original strand, 13 - 167
Target Start/End: Complemental strand, 19071607 - 19071452
Alignment:
| Q |
13 |
ggctcttattcttttgcctgtttgtcgaaatatcttga-atggcttcattctacaaaagttcggaaatttgttccctttgatgacaatattaactttcac |
111 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| |||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19071607 |
ggctcttattcttttgccggtttgtcgaaatacattgacatggcttcgttctacaaaagttcggaaatttgttccctttgatgacaatattaactttcac |
19071508 |
T |
|
| Q |
112 |
aaggtaagcggagaatcttagccatataagatgatttatatggttcataatattgt |
167 |
Q |
| |
|
||||||||||| ||||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
19071507 |
aaggtaagcggtgaatcatagccatataagatgatttatatggttcataattttgt |
19071452 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 28; Significance: 0.0000009; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 28; E-Value: 0.0000009
Query Start/End: Original strand, 82 - 117
Target Start/End: Original strand, 37066751 - 37066786
Alignment:
| Q |
82 |
gttccctttgatgacaatattaactttcacaaggta |
117 |
Q |
| |
|
||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
37066751 |
gttccatttgatgacaatatcaactttcacaaggta |
37066786 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 16192 times since January 2019
Visitors: 3768