View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1390-Insertion-40 (Length: 187)
Name: NF1390-Insertion-40
Description: NF1390
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1390-Insertion-40 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 140; Significance: 1e-73; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 140; E-Value: 1e-73
Query Start/End: Original strand, 11 - 185
Target Start/End: Complemental strand, 11825229 - 11825052
Alignment:
| Q |
11 |
ataatttgaaatatatagtttgagagctataaatttccaaaacccttaccaaaatcgtatttacataattcgtgca---gtgaagatagatatcattcac |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||| | ||||||||||||||||||||| |
|
|
| T |
11825229 |
ataatttgaaatatatagtttgagagctataaatttccaaaacccttaccgaaatcgtatttacatcattcgtatatatgtgaagatagatatcattcac |
11825130 |
T |
|
| Q |
108 |
atgaagatatatatcttcgtgtgaatgatattgtgactctctctttaaatagccaataccaactgcattattgtgaat |
185 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
11825129 |
atgaagatatatatcttcgtgtgaatgatattgtgattctctctttaaatagccaataccaacggcattattgtgaat |
11825052 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 97 - 138
Target Start/End: Original strand, 11825099 - 11825140
Alignment:
| Q |
97 |
atatcattcacatgaagatatatatcttcgtgtgaatgatat |
138 |
Q |
| |
|
|||||||||||| |||||||||||||||| |||||||||||| |
|
|
| T |
11825099 |
atatcattcacacgaagatatatatcttcatgtgaatgatat |
11825140 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 11108 times since January 2019
Visitors: 8059