View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1390-Insertion-41 (Length: 150)
Name: NF1390-Insertion-41
Description: NF1390
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1390-Insertion-41 |
| |
|
Alignment Details
Target: chr1 (Bit Score: 126; Significance: 2e-65; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 126; E-Value: 2e-65
Query Start/End: Original strand, 8 - 145
Target Start/End: Complemental strand, 32209725 - 32209588
Alignment:
Q |
8 |
atagatgagatgagcctagtagtggatgtgcagtccatctcaatttagtttggcataggtggatagtgggtcatacatgtcttgtttaatttctacaacc |
107 |
Q |
|
|
|||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
T |
32209725 |
atagatgagatgagtctagtagtggatgtgtagtccatctcaatttagtttggcataggtggatagtgcgtcatacatgtcttgtttaatttctacaacc |
32209626 |
T |
|
Q |
108 |
atatgggaccccattccatgtcatatctccaccacaaa |
145 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||| |
|
|
T |
32209625 |
atatgggaccccattccatgtcatatctccaccacaaa |
32209588 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 14181 times since January 2019
Visitors: 8375