View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1390-Insertion-43 (Length: 165)
Name: NF1390-Insertion-43
Description: NF1390
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1390-Insertion-43 |
 | |
|
| [»] chr4 (3 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 114; Significance: 4e-58; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 114; E-Value: 4e-58
Query Start/End: Original strand, 37 - 165
Target Start/End: Original strand, 54085019 - 54085148
Alignment:
| Q |
37 |
atggttgatgcc-tgcatcatgtgtgttttagtaataaaaatcagttgtgtttcaattcgaccgttgttttagtcttttcctgttatgattccaaatttc |
135 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
54085019 |
atggttgatgccatgcatcatgtgtgttttagtaataaaaatcagttgtgtttcaattcaacctttgttttagtcttttcctgttatgattccaaatttc |
54085118 |
T |
|
| Q |
136 |
caatatctacttgtaatttggcatagcttt |
165 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
54085119 |
caatatctacttgtaatttggcatagcttt |
54085148 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 60; E-Value: 7e-26
Query Start/End: Original strand, 22 - 165
Target Start/End: Original strand, 54081599 - 54081740
Alignment:
| Q |
22 |
taatgaacatgttagatggttgatgcc-tgcatcatgtgtgttttagt-aataaaaatcagttgtgtttcaa-ttcgacc-gttgttttagtcttttcct |
117 |
Q |
| |
|
||||||||| |||||||||||||| || |||||||||||||||||||| || |||||| ||||||||||||| ||| ||| ||||||||||| ||| | |
|
|
| T |
54081599 |
taatgaacacgttagatggttgattccatgcatcatgtgtgttttagtgaagaaaaattagttgtgtttcaatttcaaccttttgttttagtc--ttctt |
54081696 |
T |
|
| Q |
118 |
gttatgattccaaatttccaatatctacttgtaatttggcatagcttt |
165 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54081697 |
gttatga----aaatttccaatatctacttgtaatttggcatagcttt |
54081740 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 37; E-Value: 0.000000000004
Query Start/End: Original strand, 8 - 48
Target Start/End: Original strand, 54084954 - 54084994
Alignment:
| Q |
8 |
ggtgtgtacctaattaatgaacatgttagatggttgatgcc |
48 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
54084954 |
ggtgtgtacctaaataatgaacatgttagatggttgatgcc |
54084994 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 16070 times since January 2019
Visitors: 3757