View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1390-Insertion-46 (Length: 73)
Name: NF1390-Insertion-46
Description: NF1390
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1390-Insertion-46 |
| |
|
Alignment Details
Target: chr8 (Bit Score: 62; Significance: 2e-27; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 62; E-Value: 2e-27
Query Start/End: Original strand, 8 - 69
Target Start/End: Complemental strand, 39369350 - 39369289
Alignment:
Q |
8 |
cgttcaacacatcctcagctgcacgctttgtcagaagaagtggatgatcacatattttcttc |
69 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
39369350 |
cgttcaacacatcctcagctgcacgctttgtcagaagaagtggatgatcacatattttcttc |
39369289 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 16261 times since January 2019
Visitors: 3768