View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1390-Insertion-47 (Length: 65)
Name: NF1390-Insertion-47
Description: NF1390
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1390-Insertion-47 |
| |
|
[»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 54; Significance: 8e-23; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 54; E-Value: 8e-23
Query Start/End: Original strand, 8 - 65
Target Start/End: Original strand, 33274391 - 33274448
Alignment:
Q |
8 |
caacaaacttgtttgtgttgttgctgtttctgtttcttcctttgaattttcctccttt |
65 |
Q |
|
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
33274391 |
caacaaacttgtttgtgttattgctgtttctgtttcttcctttgaattttcctccttt |
33274448 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 12978 times since January 2019
Visitors: 8270