View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1390-Insertion-48 (Length: 276)
Name: NF1390-Insertion-48
Description: NF1390
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1390-Insertion-48 |
 | |
|
| [»] chr7 (2 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 53; Significance: 2e-21; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 224 - 276
Target Start/End: Complemental strand, 11478697 - 11478645
Alignment:
| Q |
224 |
ccattgaatgcagaggaagcaatggatactgaagcttatggaatgctacggga |
276 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11478697 |
ccattgaatgcagaggaagcaatggatactgaagcttatggaatgctacggga |
11478645 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 170 - 220
Target Start/End: Complemental strand, 11478780 - 11478730
Alignment:
| Q |
170 |
atccatccatgcatatatcaatctatctggtttgattcttttggatatgat |
220 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11478780 |
atccatcaatgcatatatcaatctatctggtttgattcttttggatatgat |
11478730 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 9649 times since January 2019
Visitors: 7932