View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1390_high_103 (Length: 319)
Name: NF1390_high_103
Description: NF1390
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1390_high_103 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 150; Significance: 3e-79; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 150; E-Value: 3e-79
Query Start/End: Original strand, 98 - 285
Target Start/End: Complemental strand, 21121424 - 21121238
Alignment:
| Q |
98 |
cttcatacctttcttggagaggaattctcaataagcagtactcagtctgttggcttagctaagttgagaaacggatgctagaaggataattgtgtggtgt |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21121424 |
cttcatacctttcttggagaggaattctcaataagcagtactcagtctgttggcttagctaagttgagaaacggatgctagaaggataattgtgtggtgt |
21121325 |
T |
|
| Q |
198 |
ttttgcactttatccttagacataagatattattattgcnnnnnnnnnnngttggaaaggataatatgatattattgtttggtcacag |
285 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21121324 |
ttttgcactttatccttagacataagatattattattgc-ttttttttttgttggaaaggataatatgatattattgtttggtcacag |
21121238 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 10172 times since January 2019
Visitors: 7975