View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1390_high_115 (Length: 283)
Name: NF1390_high_115
Description: NF1390
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1390_high_115 |
| |
|
Alignment Details
Target: chr5 (Bit Score: 154; Significance: 1e-81; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 154; E-Value: 1e-81
Query Start/End: Original strand, 115 - 272
Target Start/End: Complemental strand, 11639543 - 11639386
Alignment:
Q |
115 |
gtcttgtctcatatttgtcttccagtaactattactgctttagagttttgggttttgacctttacagtctttgattttctttttatgaggtaaattgcat |
214 |
Q |
|
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
11639543 |
gtcttgtctcatatttgtcttccagtaactagtactgctttagagttttgggttttgacctttacagtctttgattttctttttatgaggtaaattgcat |
11639444 |
T |
|
Q |
215 |
gttgatctagcattcttgtgtcatatgccatatagcatatctcattattttctttcat |
272 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
11639443 |
gttgatctagcattcttgtgtcatatgccatatagcatatctcattattttctttcat |
11639386 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 29 - 67
Target Start/End: Complemental strand, 11639610 - 11639572
Alignment:
Q |
29 |
aattgtcaactaccattatattaccatagtatatgactt |
67 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||| |
|
|
T |
11639610 |
aattgtcaactaccattatattaccatagtatatgactt |
11639572 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 13478 times since January 2019
Visitors: 8302