View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1390_high_116 (Length: 282)

Name: NF1390_high_116
Description: NF1390
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1390_high_116
NF1390_high_116
[»] chr1 (1 HSPs)
chr1 (47-237)||(19312543-19312733)
[»] chr4 (1 HSPs)
chr4 (60-171)||(8528549-8528660)
[»] chr2 (1 HSPs)
chr2 (60-133)||(5602932-5603001)


Alignment Details
Target: chr1 (Bit Score: 138; Significance: 3e-72; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 47 - 237
Target Start/End: Original strand, 19312543 - 19312733
Alignment:
47 gaatgagagtacgtctattatgggtgttcaagccgtgttgggcacatgtaaatatcttggcctcccgtcaatggtgggaagagatcgtaattttgtcttt 146  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||    
19312543 gaatgagagtacgtctattatgggtgttcaagccgtgttgggcacatgtaaatatcttggcctcccttcaatggtgggaagagatcgtaattctgtcttt 19312642  T
147 tcttatatcaaataccgtgtttggcnnnnnnntcaattcatgaagtagcaagtgtttctcaaaagtagggcgagaggtgatgattaaatct 237  Q
    |||||||||||| ||||| ||||||       ||||||| || |||||||||||| ||||||||| |||||||||||||||||||||||||    
19312643 tcttatatcaaagaccgtttttggcaaaaaaatcaattcttggagtagcaagtgtctctcaaaagcagggcgagaggtgatgattaaatct 19312733  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 56; Significance: 3e-23; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 60 - 171
Target Start/End: Original strand, 8528549 - 8528660
Alignment:
60 tctattatgggtgttcaagccgtgttgggcacatgtaaatatcttggcctcccgtcaatggtgggaagagatcgtaattttgtcttttcttatatcaaat 159  Q
    ||||| |||||||||||||| || ||||| ||| ||||||| |||||||||||||||||||||||||||||||| |||  | | || ||||||||||||     
8528549 tctataatgggtgttcaagctgttttgggtacaagtaaataccttggcctcccgtcaatggtgggaagagatcgaaatgctattttctcttatatcaaag 8528648  T
160 accgtgtttggc 171  Q
    ||||||| ||||    
8528649 accgtgtatggc 8528660  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 60 - 133
Target Start/End: Complemental strand, 5603001 - 5602932
Alignment:
60 tctattatgggtgttcaagccgtgttgggcacatgtaaatatcttggcctcccgtcaatggtgggaagagatcg 133  Q
    ||||| |||||||||||||| || ||||||||| ||||||| |||| |||||||    ||||||||||||||||    
5603001 tctataatgggtgttcaagctgttttgggcacaagtaaataccttgacctcccg----tggtgggaagagatcg 5602932  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 10292 times since January 2019
Visitors: 7975