View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1390_high_122 (Length: 269)
Name: NF1390_high_122
Description: NF1390
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1390_high_122 |
| |
|
Alignment Details
Target: chr7 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 29 - 257
Target Start/End: Complemental strand, 34771044 - 34770816
Alignment:
Q |
29 |
ctaccaagtaatgatggggaagccaatgatcaacttcttaaatacataagttgttgcagtcgcatgtaacgaaggggccacaaccgtaacaattatgtaa |
128 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||| |
|
|
T |
34771044 |
ctaccaagtaatgatggggaagccaatgatcaacttcttaaatacataagttgttgcagtcgcctgtaacgaagggtccacaaccgtaacaattatgtaa |
34770945 |
T |
|
Q |
129 |
attcatattttatgggttttcttttggcacttgatcaatcattgtgtagttgttacttactaggtgtctacttatgtatttgcacacaaattgtaataca |
228 |
Q |
|
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
34770944 |
attcatattttatgggctttcttttggcacttgatcaatcattgtgtagttgttacttactaggtgtctacttatgtatttgcacacaaattgtaataca |
34770845 |
T |
|
Q |
229 |
ttggctatattgttgtaataccttgcctt |
257 |
Q |
|
|
||||||||||||||||||||||||||||| |
|
|
T |
34770844 |
ttggctatattgttgtaataccttgcctt |
34770816 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 37 - 83
Target Start/End: Original strand, 8780692 - 8780738
Alignment:
Q |
37 |
taatgatggggaagccaatgatcaacttcttaaatacataagttgtt |
83 |
Q |
|
|
|||||||| |||| ||||||||||||||||||| || |||||||||| |
|
|
T |
8780692 |
taatgatgaggaaaccaatgatcaacttcttaattatataagttgtt |
8780738 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 14842 times since January 2019
Visitors: 8422