View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1390_high_129 (Length: 257)
Name: NF1390_high_129
Description: NF1390
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1390_high_129 |
| |
|
[»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 30 - 257
Target Start/End: Original strand, 42223087 - 42223310
Alignment:
Q |
30 |
gaaatggttccattttcctttccattcttttcacttgattgatattcaatttgttggttattattctctgtgtaaggggctttttggaatgtaaattttt |
129 |
Q |
|
|
|||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
42223087 |
gaaatgtttccattttcctttccattcttttcacttga----tattcaatttgttggttattattctctgtgtaaggggctttttggaatgtaaattttt |
42223182 |
T |
|
Q |
130 |
tcccacccacctcaacatcaaagtcgtgaataacgtattctataacataatgtgctcctgaagactgttacttggtaaataacaattaatatggtgaaat |
229 |
Q |
|
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
42223183 |
tcccacccatctcaacatcaaagtcgtgaataacgtattctataacataatgtgctcctgaagactgttacttggtaaataacaattaatatggtgaaat |
42223282 |
T |
|
Q |
230 |
gaaattgactaagaagatatttataaat |
257 |
Q |
|
|
|||||||||||||||||||||||||||| |
|
|
T |
42223283 |
gaaattgactaagaagatatttataaat |
42223310 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 16047 times since January 2019
Visitors: 3757