View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1390_high_147 (Length: 243)
Name: NF1390_high_147
Description: NF1390
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1390_high_147 |
| |
|
Alignment Details
Target: chr4 (Bit Score: 138; Significance: 3e-72; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 1 - 150
Target Start/End: Complemental strand, 3015454 - 3015305
Alignment:
Q |
1 |
tatataatgttcattccaaaattttcacctccccgctttaacagcaggaggataaacgtatccaaggccacaaaaaataacacagttgaatttaccccca |
100 |
Q |
|
|
|||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
3015454 |
tatataattttcattccaaaattttcacctccccgttttaacagcaggaggataaacgtatccaaggccacaaaaaataacacagttgaatttaccccca |
3015355 |
T |
|
Q |
101 |
atgcaagcaatacaatgttacgcaaagaaaacaagtatcgtcacaaacat |
150 |
Q |
|
|
|||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
T |
3015354 |
atgcaagcaatacaatgttatgcaaagaaaacaagtatcgtcacaaacat |
3015305 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 176 - 218
Target Start/End: Complemental strand, 3015306 - 3015264
Alignment:
Q |
176 |
atctgaattataaacgatacctttaaaatgccttgaaggatat |
218 |
Q |
|
|
|||||||||||||| |||||||||||||||||||||||||||| |
|
|
T |
3015306 |
atctgaattataaatgatacctttaaaatgccttgaaggatat |
3015264 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 9777 times since January 2019
Visitors: 7932