View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1390_high_23 (Length: 584)
Name: NF1390_high_23
Description: NF1390
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1390_high_23 |
| |
|
Alignment Details
Target: chr4 (Bit Score: 285; Significance: 1e-159; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 285; E-Value: 1e-159
Query Start/End: Original strand, 30 - 333
Target Start/End: Original strand, 31821215 - 31821519
Alignment:
Q |
30 |
gatgtaaataactcgattgatctgtgttaatattgcaggtgaaacgagctacacatgaaagccaaaatgcaatttcagtggaggaaagttacaagctagc |
129 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
31821215 |
gatgtaaataactcgattgatctgtgttaatattgcaggtgaaacgagctacacatgaaagccaaaatgcaatttcagtggaggaaagttacaagctagc |
31821314 |
T |
|
Q |
130 |
agcaggagaaattaggggacttttaatattttgatgatgagaaaattgtcttctcatctcgtgtaatgcaaattttatatttcttcccaaaaagactagt |
229 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
T |
31821315 |
agcaggagaaattaggggacttttaatattttgatgatgagaaaattgtcttctcatctcgtgtaatgcaaattttatatttcttcccgaaaagactagt |
31821414 |
T |
|
Q |
230 |
tagaaagctttagtggccaaacttagatgcttctaaaagtgaatggctgtaatctttcatgtttttgtcttttggtgtttaaattagtc-aacagacttc |
328 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
T |
31821415 |
tagaaagctttagtggccaaacttagatgcttctaaaagtgaacggttgtaatctttcatgtttttgtcttttggtgtttaaattagtcaaacagacttc |
31821514 |
T |
|
Q |
329 |
ttgca |
333 |
Q |
|
|
||||| |
|
|
T |
31821515 |
ttgca |
31821519 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 514 - 564
Target Start/End: Original strand, 31821520 - 31821570
Alignment:
Q |
514 |
ttttataatgattaaatttaattggtttaaatcttgatactcgtcggatca |
564 |
Q |
|
|
||||||||||||||||||||||||||||| ||||| |||||| |||||||| |
|
|
T |
31821520 |
ttttataatgattaaatttaattggtttatatcttcatactcatcggatca |
31821570 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 14787 times since January 2019
Visitors: 8422