View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1390_high_69 (Length: 371)
Name: NF1390_high_69
Description: NF1390
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1390_high_69 |
| |
|
Alignment Details
Target: chr5 (Bit Score: 86; Significance: 5e-41; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 86; E-Value: 5e-41
Query Start/End: Original strand, 173 - 270
Target Start/End: Complemental strand, 10568304 - 10568207
Alignment:
Q |
173 |
atttgtcaataacacccttaattattacagagtggcatttgtagagtacttaccaataggtgtttaaccgatttaacaccaaactaaatagcacctca |
270 |
Q |
|
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
T |
10568304 |
atttgtcaataacacccttaattattacagagtgacatttgtagagtacttatcaataggtgtttaaccgatttaacagcaaactaaatagcacctca |
10568207 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 264 - 342
Target Start/End: Complemental strand, 10567820 - 10567742
Alignment:
Q |
264 |
cacctcagtctcttgttggttgtcataatagattggagtttggtatcatcagttttgttaaattcttgagcattattgg |
342 |
Q |
|
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
10567820 |
caccccagtctcttgttggttgtcataatagattggagtttggtatcatcagttttgttaaattcttgagcattattgg |
10567742 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 264 - 342
Target Start/End: Complemental strand, 10583752 - 10583677
Alignment:
Q |
264 |
cacctcagtctcttgttggttgtcataatagattggagtttggtatcatcagttttgttaaattcttgagcattattgg |
342 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
T |
10583752 |
cacctcagtctcttgttggttgtcataatagattggagtttggt---ttcagttttgttaaattcttgagcattattgg |
10583677 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 77; Significance: 1e-35; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 9 - 149
Target Start/End: Complemental strand, 11413071 - 11412928
Alignment:
Q |
9 |
caacaatataagtcatttttccaggctcaagctctgtcttgtaatataatataatcaagggtcgttccacagca-taattaattagaactcttattagta |
107 |
Q |
|
|
||||||| || |||||||||||||||||||||| ||||| || |||||||||||||||||||||||||| ||| |||||||||||||||||||||| || |
|
|
T |
11413071 |
caacaatgtaggtcatttttccaggctcaagctttgtctcgtggtataatataatcaagggtcgttccactgcactaattaattagaactcttattacta |
11412972 |
T |
|
Q |
108 |
agctaaaataatgtgttttca--taaacaattggataatgatac |
149 |
Q |
|
|
||||||||||| | ||||||| |||||||||| ||||||||| |
|
|
T |
11412971 |
agctaaaataacgcgttttcactcaaacaattgggtaatgatac |
11412928 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 13101 times since January 2019
Visitors: 8270