View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1390_high_87 (Length: 348)
Name: NF1390_high_87
Description: NF1390
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1390_high_87 |
| |
|
Alignment Details
Target: chr1 (Bit Score: 132; Significance: 2e-68; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 132; E-Value: 2e-68
Query Start/End: Original strand, 89 - 316
Target Start/End: Original strand, 38666787 - 38667012
Alignment:
Q |
89 |
aacgcatttgtttgcaaagtgtgcttaattactaacaagcaaacatggtttaaagtttatggggttaagtagttcatctgatttgagttnnnnnnntaaa |
188 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
T |
38666787 |
aacgcatttgtttgcaaagtgtgcttaattactaacaagcaaacatcgtttaaagtttatggggttaagtagttcatctgatttgagttaagaaaataaa |
38666886 |
T |
|
Q |
189 |
gcgttgataaagttaaatgtgcaatatttaagttatggtaaggagnnnnnnnntactacatgacaattaacatattaatcgttgtcattnnnnnnnngat |
288 |
Q |
|
|
|||||||||||||||||||| ||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||| ||| |
|
|
T |
38666887 |
gcgttgataaagttaaatgtacaata--taagttatggtaaggaagaaaaaaatactacatgacaattaacatattaatcgttgtcattaaaaaaaagat |
38666984 |
T |
|
Q |
289 |
caaatatttgtaaaagaaatagtattat |
316 |
Q |
|
|
||||||||||||||||||| |||||||| |
|
|
T |
38666985 |
caaatatttgtaaaagaaagagtattat |
38667012 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 13992 times since January 2019
Visitors: 8375