View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1390_low_105 (Length: 331)
Name: NF1390_low_105
Description: NF1390
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1390_low_105 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 308; Significance: 1e-173; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 308; E-Value: 1e-173
Query Start/End: Original strand, 15 - 326
Target Start/End: Complemental strand, 316125 - 315814
Alignment:
| Q |
15 |
tataaggtgactcgtaatttgattacaaaatttattttgctttgttccttagaaactttattcctcttgatcagattgatctgtaaaagccatgttagaa |
114 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
316125 |
tataaggtgactcataatttgattacaaaatttattttgctttgttccttagaaactttattcctcttgatcagattgatctgtaaaagccatgttagaa |
316026 |
T |
|
| Q |
115 |
attacatgaaaaaataaatagaggaagaacatggtttgcatcaaacaacatgaggtgtatttcccaaaaggaaagaatcaggttctgtaactttctctca |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
316025 |
attacatgaaaaaataaatagaggaagaacatggtttgcatcaaacaacatgaggtgtatttcccaaaaggaaagaatcaggttctgtaactttctctca |
315926 |
T |
|
| Q |
215 |
gagtcagagtatgcagaagctgcttggaatgtcaatggttctgcggcatgcagtttatgattccgtagcatgcatccatggcatttacaaccaaaaatat |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
315925 |
gagtcagagtatgcagaagctgcttggaatgtcaatggttctgcggcatgcagtttatgattccgtagcatgcatccatggcatttacaaccaaaaatat |
315826 |
T |
|
| Q |
315 |
ttacttattcat |
326 |
Q |
| |
|
|||||||||||| |
|
|
| T |
315825 |
ttacttattcat |
315814 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 15831 times since January 2019
Visitors: 3757